View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_143 (Length: 224)
Name: NF0733_low_143
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_143 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 4 - 174
Target Start/End: Original strand, 13133641 - 13133820
Alignment:
| Q |
4 |
atacttgctgagataatgttccctatgaccgtaatgaatgtggttt-gtatgctttgaggtgtaagt--------tttaatgagttttggttcttgtccc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13133641 |
atacttgctgagataatgttccctatgaccgtaatgaatgtggttttgtatgctttgaggtgtaagtaacattgttttaatgagttttggttcttgtccc |
13133740 |
T |
|
| Q |
95 |
tcatgacacctctttatttttcatcgttttttaatnnnnnnnnttcggtggtcgttgttgtcttcttgattgatgatgtc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
13133741 |
tcatgacacctctttatttttcatcgttttttaataaaaaaaatttggtggtcgttgttgtcttcttgattgatggtgtc |
13133820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3034 times since January 2019
Visitors: 4805