View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_144 (Length: 223)

Name: NF0733_low_144
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_144
NF0733_low_144
[»] chr5 (1 HSPs)
chr5 (1-163)||(13133500-13133662)


Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 13133662 - 13133500
Alignment:
1 ggaacattatctcagcaagtatggcaacgagaaacaatactaaaataggcaggactatatgcacaagaattaccttctatataaataaatatatgagaaa 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
13133662 ggaacattatctcagcaagtatagcaacgagaaacaatactaaaataggcaggactatatgtacaagaattaccttctatataaataaatatatgagaaa 13133563  T
101 ctaaagataattttgagattccaaggaacaagatcattattagagaatgcaccatgagcttag 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13133562 ctaaagataattttgagattccaaggaacaagatcattattagagaatgcaccatgagcttag 13133500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3910 times since January 2019
Visitors: 4824