View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_147 (Length: 211)
Name: NF0733_low_147
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_147 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 31 - 126
Target Start/End: Complemental strand, 39136070 - 39135975
Alignment:
Q |
31 |
tcttaactgacagtgtagttgtatccctcttcttatgaaaccttgctgataaagcatcatcatcatcatcttcacgagaagccgattgcgatgtat |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39136070 |
tcttaactgacagtgtagttgtatccctcttcttatgaaaccttgctgataaagcatcatcatcatcatcttcacgagaagccgattgcgatgtat |
39135975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 39422795 - 39422869
Alignment:
Q |
30 |
ttcttaactgacagtgtagttgtatccctcttcttatgaaaccttgctgataaagcatcatcatcatcatcttca |
104 |
Q |
|
|
|||||||| | |||||| | ||||||||||||||| ||||||||||||| |||| | ||||||||||||||||| |
|
|
T |
39422795 |
ttcttaacaggcagtgtgatagtatccctcttcttaggaaaccttgctgacaaaggaacatcatcatcatcttca |
39422869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 100
Target Start/End: Original strand, 39416640 - 39416709
Alignment:
Q |
31 |
tcttaactgacagtgtagttgtatccctcttcttatgaaaccttgctgataaagcatcatcatcatcatc |
100 |
Q |
|
|
|||||| || ||||||||| | | ||||||||||| |||||||||||| |||| | ||||||||||||| |
|
|
T |
39416640 |
tcttaattggcagtgtagtagcacccctcttcttagcaaaccttgctgacaaaggaacatcatcatcatc |
39416709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 103
Target Start/End: Complemental strand, 19806473 - 19806401
Alignment:
Q |
31 |
tcttaactgacagtgtagttgtatccctcttcttatgaaaccttgctgataaagcatcatcatcatcatcttc |
103 |
Q |
|
|
|||| |||| |||||||||||||| ||||||||||||||||| | |||||||| |||||||||||| ||||| |
|
|
T |
19806473 |
tcttgactggcagtgtagttgtatgcctcttcttatgaaaccataatgataaagtatcatcatcatcttcttc |
19806401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 63
Target Start/End: Complemental strand, 32984802 - 32984770
Alignment:
Q |
31 |
tcttaactgacagtgtagttgtatccctcttct |
63 |
Q |
|
|
||||||||||||||||||| ||||||||||||| |
|
|
T |
32984802 |
tcttaactgacagtgtagtagtatccctcttct |
32984770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University