View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_150 (Length: 201)
Name: NF0733_low_150
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_150 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 38287245 - 38287068
Alignment:
| Q |
1 |
tcttactgttgattgagctttgtgatcgatgcatgagctaatttaaagaaaatttgtctttgtacacaaatacaccttattgactctgtaagagagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
38287245 |
tcttactgttgattgagctttgtgatcgatgcatgagctaatttaaagaaaatttgtctttgtacacaaatataccttattgactctttaagagagaaag |
38287146 |
T |
|
| Q |
101 |
aaatnnnnnnnnttatgtgaatatgtgatcgatataattaatatgttgatgataagatacaaagaaaatagagagaaaatga |
182 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38287145 |
aaataaaaaaaattatgtgaatatgtgatcgata----taatatgttgatgataagatacaaagaaaatagagagaaaatga |
38287068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4038 times since January 2019
Visitors: 4825