View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_33 (Length: 434)
Name: NF0733_low_33
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 30 - 410
Target Start/End: Original strand, 30059170 - 30059550
Alignment:
Q |
30 |
ccatcttcatcaatagacagtattcagtaatgggtattgcccaatttctcgacaaaatttcagctttatcaacttctgaatcttcaggatcgttccatat |
129 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
30059170 |
ccatcttcatctatagacagtattcagtaatgggtattgcccaatttctcgaaaaaatttcagctttatcaacttctgaatcttcaggatcgttgcatat |
30059269 |
T |
 |
Q |
130 |
tctttccagcacgattctgggattgtctgtattggaacttgcagcaatatgcgtgaacttgactcttgttctgttgtttctctttgttgtctctgttaga |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30059270 |
tctttccagcacgattctgggattgtctgtattggaacttgcagcaatatgcgtgaacttgactcttgttctgttgtttctctttgttgtctctgttaga |
30059369 |
T |
 |
Q |
230 |
aagattcttgtgtacaagagaattggaatcgttaaggacagtactacctcaaatgatagtccaatttgcagtgttattgatagagaaacgagtgatgttt |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30059370 |
aagattcttgtgtacaagagaattggaatcgttaaggacagtactacctcaaatgatagtccaatttgcagtgttattgatagagaaacgagtgatgttt |
30059469 |
T |
 |
Q |
330 |
caataggtgtttggttcaagttatctgtgttgtcttgtttctatgttttgtttgtggaagttttagtgttgagttttgatg |
410 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30059470 |
caataggtgtttggttcaagttatctgtgttgtcttgtttctatgttttgtttgtggaagttttagtgttgagttttgatg |
30059550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2808 times since January 2019
Visitors: 4801