View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_39 (Length: 369)
Name: NF0733_low_39
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 16 - 169
Target Start/End: Complemental strand, 42944288 - 42944135
Alignment:
Q |
16 |
attgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacactttttaggaac |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42944288 |
attgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacactttttaggaac |
42944189 |
T |
 |
Q |
116 |
ttgcaggttctttctgaagcttctgtctattttacaaatgaaatggcgagaata |
169 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42944188 |
ttgcaggttctttctgaagcttctgtctattttacaaatgaaatggcgagaata |
42944135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 267
Target Start/End: Complemental strand, 42944065 - 42944037
Alignment:
Q |
239 |
atatgttccaagtttaaaatggcgaccat |
267 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
42944065 |
atatgttccaagtttaaaatggcgaccat |
42944037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 25986595 - 25986684
Alignment:
Q |
8 |
ccaagaatattgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttt |
97 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || | ||||||||||| || |||||| |
|
|
T |
25986595 |
ccaaaaatattgatatgtctgcccctagttgaaaattattgatacaattgcccctgttcttctttttagttggcgaacatgaccattttt |
25986684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 54158702 - 54158617
Alignment:
Q |
18 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacac |
104 |
Q |
|
|
||||||||||||||||| || |||| ||||| || |||||||| |||||||||||| |||||||| ||| | ||||||||||||| |
|
|
T |
54158702 |
tgatatgtctgcccctatttcaaaattattgttaaaaatgcccttgttcttcaattaggttggcgaatatagc-attttttcaacac |
54158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 104
Target Start/End: Original strand, 48192825 - 48192906
Alignment:
Q |
22 |
atgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacac |
104 |
Q |
|
|
||||||||| |||||| |||| |||||||| ||||| ||||||| ||||||| ||||||||||| | ||||||||||||| |
|
|
T |
48192825 |
atgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaacatggc-attttttcaacac |
48192906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 16 - 90
Target Start/End: Complemental strand, 33813545 - 33813471
Alignment:
Q |
16 |
attgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataac |
90 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||| |||||||||||||||||| || | |||||||||||||| |
|
|
T |
33813545 |
attgatatgtctgcccctagtttaaaattattgatagaaatgcccctgttcttcattttagttggcgaacataac |
33813471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 49807002 - 49806925
Alignment:
Q |
8 |
ccaagaatattgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaac |
85 |
Q |
|
|
|||| ||||||||||| |||||||||| || |||| ||||||||||| |||| ||||||||| || |||||| |||| |
|
|
T |
49807002 |
ccaaaaatattgatatatctgcccctaattcaaaatcattgatacaaaagcccttgttcttcatttgatttggtgaac |
49806925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 11735815 - 11735895
Alignment:
Q |
18 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacata-actattttt |
97 |
Q |
|
|
|||||||||| ||||||||| |||| ||||||| ||| | ||| ||||||||| || |||||||||||||| ||||||||| |
|
|
T |
11735815 |
tgatatgtctacccctagttcaaaattattgatgcaatttcccttgttcttcattttatttggcgaacatacactattttt |
11735895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 11736338 - 11736271
Alignment:
Q |
21 |
tatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacata |
88 |
Q |
|
|
||||||||||||||||| |||| ||||||||||| ||||| | ||||||| ||||| || |||||||| |
|
|
T |
11736338 |
tatgtctgcccctagttcaaaattattgatacaattgccctttttcttcatttcatctgacgaacata |
11736271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 36155546 - 36155598
Alignment:
Q |
18 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttca |
70 |
Q |
|
|
|||||||||||||||||||||| ||||| || |||| |||||| ||||||||| |
|
|
T |
36155546 |
tgatatgtctgcccctagttgagaactaatgttacatatgcccttgttcttca |
36155598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 19182776 - 19182822
Alignment:
Q |
20 |
atatgtctgcccctagttgaaaactattgatacaaatgcccctgttc |
66 |
Q |
|
|
|||||||||||||||||| |||| |||||||||| |||||| ||||| |
|
|
T |
19182776 |
atatgtctgcccctagttcaaaagtattgatacatatgcccttgttc |
19182822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University