View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_44 (Length: 357)
Name: NF0733_low_44
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 86 - 262
Target Start/End: Original strand, 16050570 - 16050745
Alignment:
Q |
86 |
cagagaggttgtatgaatcacttatttcattggtttcaagcaaagttcaactcaagttactgtaatgaaacttgatttccagaaaccaggggagtgtaat |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16050570 |
cagagaggttgtatgaatcacttatttcattggtttcaagcaa-gttcaactcaagttactgtaatgaaacttgatttccagaaaccaggggagtgtaat |
16050668 |
T |
 |
Q |
186 |
gtgtacccaatgaaaacaaaaccattagtgagatataattataattatttagatacatacacacaaatagtccagtg |
262 |
Q |
|
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16050669 |
gtctacccaatgaaaacaaaaccattagagagatataattataattatttagatacatacacacaaatagtccagtg |
16050745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 150 - 190
Target Start/End: Original strand, 37598712 - 37598752
Alignment:
Q |
150 |
atgaaacttgatttccagaaaccaggggagtgtaatgtgta |
190 |
Q |
|
|
|||||||||||||| |||||||| || |||||||||||||| |
|
|
T |
37598712 |
atgaaacttgattttcagaaaccgggtgagtgtaatgtgta |
37598752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University