View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_45 (Length: 355)
Name: NF0733_low_45
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 8 - 192
Target Start/End: Original strand, 1025389 - 1025571
Alignment:
Q |
8 |
tgatctcaacatttacaacaaccatatccatgttatgctgaatatcttactnnnnnnnnnnngttatgctgaatatcaaccagaaaaatagtgttgctgt |
107 |
Q |
|
|
|||| ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1025389 |
tgatgtcaacatttacaacaaccatatccaagttattctgaatatcttactaaaaaaaaa--gttatgctgaatatcaaccagaaaaatagtgttgctgt |
1025486 |
T |
 |
Q |
108 |
tttattatgattttttgtcctcgaaatcataacataaagtatcgcaaaaacaatcagaattaaaaattcacctacatggtatcgt |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
1025487 |
tttattatgattttttgtcctcgaaatcataatataaagtatcgcaaaaataatcagaattaaaaattcacctacatggtatcgt |
1025571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University