View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_46 (Length: 354)
Name: NF0733_low_46
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 1025389 - 1025571
Alignment:
| Q |
8 |
tgatctcaacatttacaacaaccatatccatgttatgctgaatatcttactnnnnnnnnnngttatgctgaatatcaaccagaaaaatagtgttgctgtt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025389 |
tgatgtcaacatttacaacaaccatatccaagttattctgaatatcttactaaaaaaaaa-gttatgctgaatatcaaccagaaaaatagtgttgctgtt |
1025487 |
T |
 |
| Q |
108 |
ttattatgattttttgtcctcgaaatcataacataaagtatcgcaaaaacaatcagaattaaaaattcacctacatggtatcgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1025488 |
ttattatgattttttgtcctcgaaatcataatataaagtatcgcaaaaataatcagaattaaaaattcacctacatggtatcgt |
1025571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University