View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_54 (Length: 337)
Name: NF0733_low_54
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 28 - 327
Target Start/End: Complemental strand, 36490223 - 36489921
Alignment:
Q |
28 |
caaatcaatatatgcgcatccttctcttgtttagtaattttattccactgtgacttggatctccacttatctgataatgtgttattaactttttctttac |
127 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
36490223 |
caaatcaatatatgcgcatccttcttttgtttagtaattttattccactgtgacttggatctccacttatccgataatgtgttattaactttttctttac |
36490124 |
T |
 |
Q |
128 |
ttaaaattctcacagtcctgatgatcgaggaactaataat---tttatttttatctacattggatatttttaattaaatgttcagtcccataaaactgta |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36490123 |
ttaaaattctcacagtcctgatgatcgaggaactaataatatttttttttttatctacattggatatttttaattaaatgttcagtcccataaaactgta |
36490024 |
T |
 |
Q |
225 |
gaaaagtgtagcaaaaagagaaagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgccttttcccgcct |
324 |
Q |
|
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36490023 |
gaaaagtgtagcacaaagagatagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgccttttcccgcct |
36489924 |
T |
 |
Q |
325 |
atg |
327 |
Q |
|
|
||| |
|
|
T |
36489923 |
atg |
36489921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3891 times since January 2019
Visitors: 4823