View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_62 (Length: 323)
Name: NF0733_low_62
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 33130112 - 33129995
Alignment:
Q |
103 |
atctaccccacgggaaaattgaatacttaagcaaatgcccctttggttatcattttaactcataaaaattccattgcatatgactcaattcaagaaaata |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
T |
33130112 |
atctaccccacgggaaaattgaatacttaagcaaatgcccctttggttatcattttaactc--aaagattccattgcatatgactcaatttaagaaaata |
33130015 |
T |
 |
Q |
203 |
tacagttaccagaatatatt |
222 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
33130014 |
tacagttaccagaatatatt |
33129995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University