View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_66 (Length: 314)
Name: NF0733_low_66
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 111 - 223
Target Start/End: Original strand, 33489774 - 33489886
Alignment:
| Q |
111 |
taaaggcgtactctaacccaaaacaaaattataggaggatccatccaactttaggcagcaacactaagtaaagagacaatgaccaccataacaccaattt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33489774 |
taaaggcgtactctaacccaaaacaaaattataggaggatccatccaactttaggcagcaacactaagtaaagagacaatgaccaccataccaccaattt |
33489873 |
T |
 |
| Q |
211 |
ttatgatggttat |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33489874 |
ttatgatggttat |
33489886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University