View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_68 (Length: 313)
Name: NF0733_low_68
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_68 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 106 - 238
Target Start/End: Complemental strand, 6350466 - 6350334
Alignment:
| Q |
106 |
catgattgctaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcacccattgagtggtgacaatgacactttccgacaag |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6350466 |
catgattggtaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcatccattgagtggtgacaatgacactttccgacaag |
6350367 |
T |
|
| Q |
206 |
gctcaattattcaattgctaggttgcctatgat |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||| |
|
|
| T |
6350366 |
gctcgattattcaattgctaggttgcctttgat |
6350334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3347 times since January 2019
Visitors: 4812