View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_75 (Length: 297)
Name: NF0733_low_75
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_75 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 89 - 274
Target Start/End: Original strand, 4243604 - 4243789
Alignment:
| Q |
89 |
ccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243604 |
ccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaa |
4243703 |
T |
|
| Q |
189 |
gtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcata |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243704 |
gtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcata |
4243789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 94 - 274
Target Start/End: Original strand, 6186665 - 6186845
Alignment:
| Q |
94 |
atcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaagttta |
193 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||| |||||| |||||||||| |||||||| || ||||| || ||| |
|
|
| T |
6186665 |
atcagtctttgtattcccggtgaaatatcgaaccaagagaacaaccaggactaaaaacgcgacaaccaaaccaacttttccgatcgatgatgttagctta |
6186764 |
T |
|
| Q |
194 |
ttcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcata |
274 |
Q |
| |
|
|||||||||||||||||||| ||||| || | ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6186765 |
ttcaaccttgtttgcaaaggtgtttcctcatcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcata |
6186845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5587 times since January 2019
Visitors: 4857