View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_83 (Length: 289)
Name: NF0733_low_83
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 155 - 266
Target Start/End: Complemental strand, 2759281 - 2759167
Alignment:
| Q |
155 |
taatagaaattcatcatggaggag---atacacgagatgagattaaaataaaggacaataataatgttccttatattattcactatgtttatgcaccaca |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759281 |
taatagaaattcatcatggaggaggagatacacgagatgagattaaaataaaggacaataataatgttccttatattattcactatgtttatgcaccaca |
2759182 |
T |
|
| Q |
252 |
acttttcagagatga |
266 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
2759181 |
acttttcagtgatga |
2759167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3186 times since January 2019
Visitors: 4808