View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_83 (Length: 289)

Name: NF0733_low_83
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_83
NF0733_low_83
[»] chr8 (1 HSPs)
chr8 (155-266)||(2759167-2759281)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 155 - 266
Target Start/End: Complemental strand, 2759281 - 2759167
Alignment:
155 taatagaaattcatcatggaggag---atacacgagatgagattaaaataaaggacaataataatgttccttatattattcactatgtttatgcaccaca 251  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2759281 taatagaaattcatcatggaggaggagatacacgagatgagattaaaataaaggacaataataatgttccttatattattcactatgtttatgcaccaca 2759182  T
252 acttttcagagatga 266  Q
    ||||||||| |||||    
2759181 acttttcagtgatga 2759167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University