View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_84 (Length: 289)
Name: NF0733_low_84
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_84 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 93 - 289
Target Start/End: Original strand, 37137373 - 37137570
Alignment:
| Q |
93 |
gacatcatcatcaattctttgtgaatattcaataatcatgaaaaccagaagagattacaagtgaatattttgaaaatgttgtgattcgtggttttaaatt |
192 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37137373 |
gacattatcatcaattctttgtgaatattcaataatcatgaaaactagaagagattacaagtgaatattttgaaaatgttgtgattcgtggctttaaatt |
37137472 |
T |
|
| Q |
193 |
gtggtttgcaaccaaaattacatacaaatgatgaagaattttgaggtctc-tacaacgacaaatataatagcacagactatattttgcagcaatataa |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||| |||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
37137473 |
gtggtttgcaaccataattacatacaaatgatgaagaattttgaggtctcttgcaacgaaaaatttaatagcaccgactatattttgctccaatataa |
37137570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4694 times since January 2019
Visitors: 4838