View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_87 (Length: 285)
Name: NF0733_low_87
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_87 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 26194155 - 26194405
Alignment:
Q |
7 |
tccaagaatatgggcatatttcttttgcttcatccacagtcaactgcatgattacaaatgaaagaaatattaggatactaacaaaaaataataatagtaa |
106 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26194155 |
tccaagcatatgggcatatttcttttgcttcatccacagtcaactgcatgattacaaatgaaagaaatattaggatactaacaaaaaataataatagtaa |
26194254 |
T |
 |
Q |
107 |
agaaagaatgatacttaattaagatattgcaatttgcaagatgaattgacatttgagtatgacacaaaaatttataaatgccacttgattaggatcaagg |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
26194255 |
agaaagaatgatacttaattaagatattgcaatttgcaagatgaattgacatttgagtatgacacaaaaatttataaatgccacatgattaggatcaagg |
26194354 |
T |
 |
Q |
207 |
ttttgaaaaacatatatgcaacctcaatctgcgccgcgacgtcaggatttt |
257 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26194355 |
ttttgaaaaacatatatgcaacctcaatctgcgccgcgacgtcaggatttt |
26194405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 196 - 259
Target Start/End: Original strand, 26194447 - 26194510
Alignment:
Q |
196 |
taggatcaaggttttgaaaaacatatatgcaacctcaatctgcgccgcgacgtcaggattttga |
259 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||| |||||||| |
|
|
T |
26194447 |
taggatcaaggttttgaaaaacatatatgcaacatcaatctgcgctgcgacatcaagattttga |
26194510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5065 times since January 2019
Visitors: 4845