View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_93 (Length: 279)
Name: NF0733_low_93
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_93 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 48 - 242
Target Start/End: Original strand, 30336689 - 30336883
Alignment:
| Q |
48 |
tgtgcaaattagttattgtacttatatttcagcaggatattaatttggacataatgtaattcctgcatagacaaatggagttggccgcgttgagacgtag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30336689 |
tgtgcaaattagttattgtacttatatttcagcaggatattaatttggacataatgtaattcctgcatagacaaatggagttggccgcgttgagacgtag |
30336788 |
T |
|
| Q |
148 |
tttacaacatcaaatttgaaatatatccatgatgaagagtaatttgttgctgccggtacatgtgtacttttatgtggccttatgtggtctgtgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30336789 |
tttacaacatcaaatttgaaatatatccatgatgaatagtaatttgttgctgccggtacatgtgtacttttatgtggccttatgtggtctttgct |
30336883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5407 times since January 2019
Visitors: 4850