View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_97 (Length: 271)
Name: NF0733_low_97
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_97 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 29 - 128
Target Start/End: Original strand, 42325449 - 42325548
Alignment:
| Q |
29 |
gatgaaaatgcaactccatttacaatattggtttgattcacattcaacccgatcttgcaatggacattagacttatttatgatcttaatgttgttgatta |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
42325449 |
gatgaaaatgcaactccatttacaatattggtttgattcacattcaacccgatcttgcaatggaccttagaattatttatgatcttaatgttgttgatta |
42325548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 158
Target Start/End: Original strand, 42315640 - 42315765
Alignment:
| Q |
31 |
tgaaaatgcaactccatttacaatattggtttgattcacattcaacccgatcttgcaatggacattagacttatttatgatcttaatgttgttgattacg |
130 |
Q |
| |
|
||||||||||||||||||| || ||| |||| | |||| ||||||| ||||||| || ||| | |||| ||||||||||||||| ||||||||||| |
|
|
| T |
42315640 |
tgaaaatgcaactccatttgca-tat-ggttcgggtcacgttcaacctaatcttgctatagaccctggactaatttatgatcttaatattgttgattact |
42315737 |
T |
|
| Q |
131 |
tgaacctattatctggttataataaaaa |
158 |
Q |
| |
|
||| |||||||| || |||||||||||| |
|
|
| T |
42315738 |
tgagcctattatgtgtttataataaaaa |
42315765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 42315791 - 42315831
Alignment:
| Q |
155 |
aaaaagcctttcatttgtccagagtcctacaatgaggtgga |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
42315791 |
aaaaagcctttcatttgtcctgagtcctacaatgtggtgga |
42315831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3147 times since January 2019
Visitors: 4805