View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_98 (Length: 269)
Name: NF0733_low_98
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_98 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 40224228 - 40224460
Alignment:
| Q |
30 |
aaaacaaagtgttgggcaaattaccagaaaaattatctggtacgaggatgtaactatcttggtctgagcaactctttcttgtttctgtcgcagaccctga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224228 |
aaaacaaagtgttgggcaaattaccagaaaaattatctggtacgaggatgtaactatcttggtctgagcaactctttcttgtttctgtcgcagaccctga |
40224327 |
T |
 |
| Q |
130 |
gtgagtcccacaaagattaaacaaaataatgtctcaatttcaacacgaaaaacgtaaaatgaaaccaaactcaaagaaaaccaatcacaatcttaattaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224328 |
gtgagtcccacaaagattaaacaaaataatgtctcaatttcaacacgaaaaacgtaaaatgaaaccaaactcaaagaaaaccaatcacaatcttaattaa |
40224427 |
T |
 |
| Q |
230 |
aataattgagtttcacctgtaacagaataatct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40224428 |
aataattgagtttcacctgtaacagaataatct |
40224460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University