View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_17 (Length: 296)
Name: NF0734_low_17
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0734_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 74 - 150
Target Start/End: Complemental strand, 48600503 - 48600427
Alignment:
Q |
74 |
tgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg |
150 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48600503 |
tgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg |
48600427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 239
Target Start/End: Complemental strand, 48600373 - 48600338
Alignment:
Q |
204 |
attatcgttcatgatgttctaatggggtgacttcat |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
48600373 |
attatcgttcatgatgttctaatggggtgacttcat |
48600338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University