View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_20 (Length: 284)
Name: NF0734_low_20
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0734_low_20 |
 |  |
|
[»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 111 - 241
Target Start/End: Original strand, 226896 - 227026
Alignment:
Q |
111 |
gcaacctcttcacaatgctcctccttccaccattccctcaccgactttctcttctctttcctcatcatcccgccaacattttcctcgtccatcgattccc |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
226896 |
gcaacctcttcacaatgctcctccttccaccattccctcaccgactttctcttctctttcctcatcatcccaccaacaatttcctcgtccatcgattccc |
226995 |
T |
 |
Q |
211 |
accattccaatttctgcttcctcttcttctc |
241 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
226996 |
accattccaatttctgcttcctcttcttctc |
227026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University