View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_23 (Length: 276)
Name: NF0734_low_23
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 35 - 118
Target Start/End: Complemental strand, 30887138 - 30887055
Alignment:
| Q |
35 |
ttattcttgaaaaagttaaggtaatttaatcaccatatacttatattagtccgtctctttcaattttgatatgcttgctgcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887138 |
ttattcttgaaaaagttaaggtaatttaatcaccatatacttatattaatccgtctctttcaattttgatatgcttgctgcata |
30887055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 153 - 222
Target Start/End: Complemental strand, 30887020 - 30886951
Alignment:
| Q |
153 |
gattaactgattcagggacctaagtatcaagagattgttaatattcggttaggagatggaacgactaggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30887020 |
gattaactgattcagggacctaagtatcaagagattgttaatattcggttaggagatggaacgactaggc |
30886951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 51174508 - 51174565
Alignment:
| Q |
157 |
aactgattcagggacctaagtatcaagagattgttaatattcggttaggagatggaac |
214 |
Q |
| |
|
||||| |||||||||| || |||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
51174508 |
aactgcttcagggacccaaatatcaagagattgtcaatattcgtttaggcgatggaac |
51174565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University