View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_28 (Length: 267)
Name: NF0734_low_28
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 28 - 227
Target Start/End: Original strand, 11711973 - 11712172
Alignment:
| Q |
28 |
atgaatactggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctcca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11711973 |
atgaatactggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctcca |
11712072 |
T |
 |
| Q |
128 |
aggaagctatatcactgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatga |
227 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712073 |
aggaagctatatcattgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatga |
11712172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University