View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_32 (Length: 261)
Name: NF0734_low_32
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 32 - 170
Target Start/End: Original strand, 32297506 - 32297644
Alignment:
| Q |
32 |
attagggatttcgagaatagcacaatcatcgtcttcgcttcaaattcaaacttcaattttcgatccatatctttcattttcagcttcaaccacaagatct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32297506 |
attagggatttcgagaatagcacaatcatcgtcttcgcttcaaattcaaacttcaattttcgatccatatctttcattttcagcttcaaccacaagatct |
32297605 |
T |
|
| Q |
132 |
ttttctcaatctcaattggtcaaatccaatggcaaacac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32297606 |
ttttctcaatctcaattggtcaaatccaatggcaaacac |
32297644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3942 times since January 2019
Visitors: 4824