View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0734_low_32 (Length: 261)

Name: NF0734_low_32
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0734_low_32
NF0734_low_32
[»] chr8 (1 HSPs)
chr8 (32-170)||(32297506-32297644)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 32 - 170
Target Start/End: Original strand, 32297506 - 32297644
Alignment:
32 attagggatttcgagaatagcacaatcatcgtcttcgcttcaaattcaaacttcaattttcgatccatatctttcattttcagcttcaaccacaagatct 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32297506 attagggatttcgagaatagcacaatcatcgtcttcgcttcaaattcaaacttcaattttcgatccatatctttcattttcagcttcaaccacaagatct 32297605  T
132 ttttctcaatctcaattggtcaaatccaatggcaaacac 170  Q
    |||||||||||||||||||||||||||||||||||||||    
32297606 ttttctcaatctcaattggtcaaatccaatggcaaacac 32297644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3942 times since January 2019
Visitors: 4824