View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_35 (Length: 251)
Name: NF0734_low_35
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 71 - 249
Target Start/End: Original strand, 32769106 - 32769284
Alignment:
| Q |
71 |
gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769106 |
gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt |
32769205 |
T |
 |
| Q |
171 |
aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcatatgagatgtattcacccg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769206 |
aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcatatgagatgtattcacccg |
32769284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 32768823 - 32768864
Alignment:
| Q |
7 |
tcgaataatatacaaaaggaatcaactgcgtttatatgataa |
48 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
32768823 |
tcgaataaaataccaaaggaatcaattgcgtttatatgataa |
32768864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University