View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0734_low_35 (Length: 251)

Name: NF0734_low_35
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0734_low_35
NF0734_low_35
[»] chr3 (2 HSPs)
chr3 (71-249)||(32769106-32769284)
chr3 (7-48)||(32768823-32768864)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 71 - 249
Target Start/End: Original strand, 32769106 - 32769284
Alignment:
71 gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32769106 gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt 32769205  T
171 aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcatatgagatgtattcacccg 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32769206 aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcatatgagatgtattcacccg 32769284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 32768823 - 32768864
Alignment:
7 tcgaataatatacaaaaggaatcaactgcgtttatatgataa 48  Q
    |||||||| |||| ||||||||||| ||||||||||||||||    
32768823 tcgaataaaataccaaaggaatcaattgcgtttatatgataa 32768864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University