View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_38 (Length: 242)
Name: NF0734_low_38
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0734_low_38 |
 |  |
|
[»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 7247289 - 7247384
Alignment:
Q |
1 |
tgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttggttttgctgt |
96 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
7247289 |
tgtctctgacatcttttacacaaattcataaactaatgtacaaagaaaaaattaaatgcaaatgcatgttagtccatgcacctttggttttgctgt |
7247384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 25321465 - 25321379
Alignment:
Q |
1 |
tgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
87 |
Q |
|
|
||||||| |||||||||||| ||||||| || |||||||||| ||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
25321465 |
tgtctctaacatcttttacaaaaattcactaataaatgtacaaataaaaactaaatttcaaatgcatgttggtccattcacctttgg |
25321379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 18418 - 18505
Alignment:
Q |
1 |
tgtctctgacatctttt-acagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
87 |
Q |
|
|
|||| |||||||||||| ||| ||||||| || |||||||||||||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
18418 |
tgtcactgacatctttttacaaaaattcacaaggaaatgtacaaagaaaaactaaatttcaaatgcatgttggtccattcacctttgg |
18505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University