View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_39 (Length: 239)
Name: NF0734_low_39
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 36127831 - 36128001
Alignment:
| Q |
1 |
gaagttgagttgacattgaagctagggatgaagaattagcacttgtcgagaatttgttcaagaattgaattatatgtgcttgtctatcaccagcaatagc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127831 |
gaagttgagttgacattgaagttagggatgaagaattagcacttgtcgagaatttgttcaagaattgaattatatgtgcttgtctatcaccagcaatagc |
36127930 |
T |
|
| Q |
101 |
ttgttcatgtgccatcaactcaagctctttgttcattttctccatctcttgtttcttccaagcttcatctc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36127931 |
ttgttcatgtgccatcaactcaagctctttgttcattttctccatctcttgtttcttccaagcttcttctc |
36128001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3803 times since January 2019
Visitors: 4821