View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_40 (Length: 238)
Name: NF0734_low_40
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0734_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 5 - 170
Target Start/End: Complemental strand, 47245699 - 47245534
Alignment:
Q |
5 |
atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcacattcatgactttgattcctaaagcggttagcccgcataa |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47245699 |
atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcgcattcatgactttgattcctaaagcggttagcccgcataa |
47245600 |
T |
 |
Q |
105 |
gttatcagattttcaactgattccttcattagttgtatttatatattcatttcatctcactcgacc |
170 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||| |||||| |||||| |
|
|
T |
47245599 |
gttatcagattttcaactgattccatcattagttgtatttatatgtttatttaatctcattcgacc |
47245534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University