View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_43 (Length: 217)
Name: NF0734_low_43
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 18352819 - 18352951
Alignment:
| Q |
1 |
tgtgaaggatcctaattatggtggttagaaagaactaagaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18352819 |
tgtgaaggatcctaattatggtggttagaaagaactatgaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct |
18352918 |
T |
|
| Q |
101 |
tacgagtaatgccagctgataacactcatttta |
133 |
Q |
| |
|
||||||||||||||| | || |||||||||||| |
|
|
| T |
18352919 |
tacgagtaatgccagttaatgacactcatttta |
18352951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5590 times since January 2019
Visitors: 4857