View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0734_low_9 (Length: 390)
Name: NF0734_low_9
Description: NF0734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0734_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 58 - 294
Target Start/End: Original strand, 9161623 - 9161859
Alignment:
| Q |
58 |
atgaacacacatagaattagttgcattatcatacttcattttccatcacaatagttgcatgcagatttcttttctatgtctattgtgaaatgattccatg |
157 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9161623 |
atgaacacacatagaactagttgcattatcatacttcattttccatcacaatagttgcatgcagatttcttttctatgtctattgtgaaatgattccatg |
9161722 |
T |
|
| Q |
158 |
actctgagcagttcttatgcttcttaaagcgaggaggtttgcactattagagactgtgggtataggggtagaaactgcatgcnnnnnnncaagaaattaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9161723 |
actctgagcagttcttatgcttcttaaagcgaggaggtttgcactattagagactgtgggtataggggtagaaactgcatgctttttttcaagaaattaa |
9161822 |
T |
|
| Q |
258 |
ctggtttaagctgtttatgcaaatgcattagtgtaac |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9161823 |
ctggtttaagctgtttatgcaaatgcattagtgtaac |
9161859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4400 times since January 2019
Visitors: 4835