View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_15 (Length: 346)
Name: NF0735_high_15
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 259
Target Start/End: Complemental strand, 33179995 - 33179740
Alignment:
| Q |
5 |
tgtcgaataatatattcgtgggattatgattttcttgtttttaattatgtgcttatttgggaaagatcaaaagtgtttgaagtcattttgaaggaaagag |
104 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33179995 |
tgtccaatattatattcgtgggcttatgattttcttgtttttaattatgtgcttatttgggaaagatcaaaagtgtttgaagtcattttgaaggaaagag |
33179896 |
T |
|
| Q |
105 |
aggatgaaacacaaacaaaaata--gttgtatactttatatgcaggtatagattattttagtttgcctaagttattacataaatagctttcaaatcgacc |
202 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33179895 |
agggtgaaacacaaacaaaaatattgttgtatactttatatgcaggtatagattattttagtttgcctaagttattacataaatagctttcaaatcgacc |
33179796 |
T |
|
| Q |
203 |
atttatatttctctnnnnnnnntcgaccatttatatgatttttatggaattctactt |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
33179795 |
atttatatttctct-aaaaaattcgaccatttatatgatttttatggaatcctactt |
33179740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4710 times since January 2019
Visitors: 4838