View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_19 (Length: 302)
Name: NF0735_high_19
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 114 - 189
Target Start/End: Complemental strand, 7844969 - 7844894
Alignment:
Q |
114 |
taggtagcaaaaggccatacacttaagcaaatgtaagaagattgttcaatataaacacttaacaaatgctcataaa |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7844969 |
taggtagcaaaaggccatacacttaagcaaatgtaagaagattgttcaatataaacacttaacaaatgctcataaa |
7844894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 114 - 189
Target Start/End: Complemental strand, 7838970 - 7838895
Alignment:
Q |
114 |
taggtagcaaaaggccatacacttaagcaaatgtaagaagattgttcaatataaacacttaacaaatgctcataaa |
189 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
7838970 |
taggtagcaaaaggccatacacttgagcaaatgtaagaagattgttcaatataaacacttaagaaatgctcataaa |
7838895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University