View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_30 (Length: 258)
Name: NF0735_high_30
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 30079348 - 30079462
Alignment:
Q |
1 |
gcaggacagaatgaggcatttagagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30079348 |
gcaggacagaatgaggcatttagagaggaagtggcttttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgag |
30079447 |
T |
 |
Q |
101 |
caatgcagaagttca |
115 |
Q |
|
|
||||||||||||||| |
|
|
T |
30079448 |
caatgcagaagttca |
30079462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 39485777 - 39485686
Alignment:
Q |
23 |
gagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgagcaatgcagaagttc |
114 |
Q |
|
|
|||||||| ||||| ||||| ||||| || || || ||||||| ||||| ||||| || ||||||||| ||||||||||||| || ||||| |
|
|
T |
39485777 |
gagaggaaatggcttttctcttttgcgggtgcacctcgtcctggtaatgcaaaatcgattaggggtcagataattgagcaatgtaggagttc |
39485686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University