View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_31 (Length: 257)
Name: NF0735_high_31
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 3852020 - 3851779
Alignment:
| Q |
1 |
gtaactaaccaactagaagcaatatacttcctttgtcacaagcctaaagatattatcacatacatcaaaattcatattataattcattttatttaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852020 |
gtaactaaccaactagaagcaatatacttcctttgtcacaagcctaaagatattatcacatacatcaaaattcatattataattcattttatttaagctt |
3851921 |
T |
|
| Q |
101 |
gtaaccaaacaagcacttactagatgccttcaaacttgcaatgcaaaaatgtgtgtgttggggatttggttgtggacctgactgaccgaccatcaaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3851920 |
gtaaccaaacaagcacttactagatgccttcaaacttgcaatgcaaaaatgtctgtgttggggatttgtttgtggacctgactgaccgaccatcaaacag |
3851821 |
T |
|
| Q |
201 |
ttttttcacgtttgtaaggactgaaatattccaattccattt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3851820 |
ttttttcacgtttgtaaggactgaaatattccaattccattt |
3851779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4716 times since January 2019
Visitors: 4838