View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_high_40 (Length: 233)

Name: NF0735_high_40
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_high_40
NF0735_high_40
[»] chr6 (1 HSPs)
chr6 (38-78)||(32215682-32215722)


Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 32215722 - 32215682
Alignment:
38 taagaattattgcttacacatagcaactagatgtaccaact 78  Q
    |||||||||||||||||||||||||||||||||||||||||    
32215722 taagaattattgcttacacatagcaactagatgtaccaact 32215682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5663 times since January 2019
Visitors: 4858