View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_high_42 (Length: 222)

Name: NF0735_high_42
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_high_42
NF0735_high_42
[»] chr8 (1 HSPs)
chr8 (93-204)||(1016895-1017006)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 93 - 204
Target Start/End: Original strand, 1016895 - 1017006
Alignment:
93 ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1016895 ctttcatgacacatcagctccggcagccctggcaccgatttcacggagtccaagttttcggagcattttctttggggagaattgggcggagctgccgctg 1016994  T
193 aaggaggatgat 204  Q
    ||||||||||||    
1016995 aaggaggatgat 1017006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University