View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_high_45 (Length: 218)

Name: NF0735_high_45
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_high_45
NF0735_high_45
[»] chr6 (1 HSPs)
chr6 (1-90)||(32215734-32215823)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 32215734 - 32215823
Alignment:
1 agtatggattatctttatgtttttttaatttaattnnnnnnnnctttttctttattattcttttatgttagaaattccgtctttattgtg 90  Q
    |||||||||||||||||||| |||||||||| |||        |||||||||||||||||||||||||||||||||||||||||||||||    
32215734 agtatggattatctttatgtctttttaatttgattaaaaaaaactttttctttattattcttttatgttagaaattccgtctttattgtg 32215823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University