View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_46 (Length: 216)
Name: NF0735_high_46
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 43287167 - 43287285
Alignment:
Q |
17 |
gaacctgtgttcgtgcaaattttttccatttatgtgaaaatatgcaattgatgcatttgtctcctgaaacttgtgacaggcatgtgatgcctcacctaat |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43287167 |
gaacctgtgttcgtgcaaattttttccatttatgtgaaaatatgcaattgatgcatttgtctcctgaaacttgtgacaggcatgtgatgcctcacctaat |
43287266 |
T |
 |
Q |
117 |
caagatcttggttgctttc |
135 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
43287267 |
caagatcttggttgctttc |
43287285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5567 times since January 2019
Visitors: 4857