View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_high_8 (Length: 442)
Name: NF0735_high_8
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_high_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 30 - 442
Target Start/End: Complemental strand, 3852434 - 3852026
Alignment:
| Q |
30 |
ttttcgatctcaacttgccaccttcatcataagaagatgatcctagtgttctttctgatcgatgcctaactaagctataagttcttttaggagtactaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852434 |
ttttcgatctcaacttgccaccttcatcataagaagttgatcctagtgttctttctgat----gcctaactaagctataagttcttttaggagtactaat |
3852339 |
T |
|
| Q |
130 |
ccaactcggtacattagagtttacaacactcacacacatcgcgctagaccagaccacgatgatggtgtggtatggataattggatatcactatatatttg |
229 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852338 |
ccaacttggtacattagagtttacaacactcacacacatcgcgctagaccagaccacgatgatggtgtggtatggataattggatatcactatatatttg |
3852239 |
T |
|
| Q |
230 |
agtagttgttttcttactttatgacatttgggtaaagttagtatatgattatta--nnnnnnnngttttaaagtagctaggtaaaagca-ttgtattatc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3852238 |
agtagttgttttcttactttatgacatttgggtaaagttagtatatgattattattttttttttgttttaaagtagctaggtaaaagcatttgtattatc |
3852139 |
T |
|
| Q |
327 |
tttatcagtagcataacttatgatatatgttttcaccaactgtatagtatgatgatgtatggtggcatttaatctggcttctcttcattgtacttaattt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3852138 |
tttatcagtagcataacttatgatatatgttttcaccaactgtatagt---atgatgtatggtggcatttaatttggcttctcttcattgtacttaattt |
3852042 |
T |
|
| Q |
427 |
ggcttctcttctcttc |
442 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3852041 |
ggcttctcttctcttc |
3852026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2759 times since January 2019
Visitors: 4801