View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_26 (Length: 318)

Name: NF0735_low_26
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_26
NF0735_low_26
[»] chr5 (1 HSPs)
chr5 (98-235)||(7723728-7723868)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 98 - 235
Target Start/End: Complemental strand, 7723868 - 7723728
Alignment:
98 gcatcttctggttctgtggttgtacgtaccatgagttgttgttgttgt---gatggtggtggtggttatacatcgaagctgactccattacgccaataga 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
7723868 gcatcttctggttctgtggttgtacgtaccatgagttgttgttgttgttgtgatggtggtggtggttatacatcgaagctgactccattacgccaataga 7723769  T
195 tggcgctgtcgctgtgccggcggcagaagttgctcttctct 235  Q
    |||||||||||||||||| ||||||||||||||||||||||    
7723768 tggcgctgtcgctgtgccagcggcagaagttgctcttctct 7723728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University