View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_26 (Length: 318)
Name: NF0735_low_26
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 98 - 235
Target Start/End: Complemental strand, 7723868 - 7723728
Alignment:
| Q |
98 |
gcatcttctggttctgtggttgtacgtaccatgagttgttgttgttgt---gatggtggtggtggttatacatcgaagctgactccattacgccaataga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723868 |
gcatcttctggttctgtggttgtacgtaccatgagttgttgttgttgttgtgatggtggtggtggttatacatcgaagctgactccattacgccaataga |
7723769 |
T |
|
| Q |
195 |
tggcgctgtcgctgtgccggcggcagaagttgctcttctct |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7723768 |
tggcgctgtcgctgtgccagcggcagaagttgctcttctct |
7723728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3215 times since January 2019
Visitors: 4808