View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_28 (Length: 317)
Name: NF0735_low_28
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 87 - 220
Target Start/End: Original strand, 39333148 - 39333281
Alignment:
| Q |
87 |
agggtcaacgcatttatggttccctgttatactactgcacactcatatccatacgtaacaataatcttcatccaaccgctggggatatccaacgtcaaca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39333148 |
agggtcaacgcatttatggttccctgttatactactgcacactcagatccatacgtaacaataatcttcatccaaccgctggggatatctaacgtcaaca |
39333247 |
T |
|
| Q |
187 |
acaatcgcatcgaccataaaataatgatacgaaa |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
39333248 |
acaatcgcatcgagcataaaataatgatacgaaa |
39333281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4529 times since January 2019
Visitors: 4835