View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_29 (Length: 316)
Name: NF0735_low_29
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 253
Target Start/End: Complemental strand, 38466344 - 38466098
Alignment:
| Q |
7 |
cctttggtcactgccactgttaaaaacttgtgtggtgattttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466344 |
cctttggtcactgccactgttaaaaacttgtgtggtgattttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtg |
38466245 |
T |
|
| Q |
107 |
atgcatggcggttttgtaaggtacataccgttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466244 |
atgcatggcggttttgtaaggtacataccgttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagttt |
38466145 |
T |
|
| Q |
207 |
agccagtgaaatcttatcctacgttagttagggtatgggcctatgat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466144 |
agccagtgaaatcttatcctacgttagttagggtatgggcctatgat |
38466098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3954 times since January 2019
Visitors: 4824