View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_31 (Length: 308)
Name: NF0735_low_31
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 68 - 239
Target Start/End: Original strand, 38531295 - 38531466
Alignment:
Q |
68 |
gttttgttgaataacgtttgtctaggtttaacaaacatgaagcatttaacaaaccatatatgtttggcaaagttttccggaaagaaaatctaacgaggta |
167 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38531295 |
gttttgttgaataacgtttgtcaaggtttaacaaacatgaagcatttaacaaaccatatatgtttggcaaagttttccggaaagaaaatctaacgaggta |
38531394 |
T |
 |
Q |
168 |
ggtttttataagttttccnnnnnnnntaaagagaaaagtgaaatcacgaaaatgattctggagtatgcgaga |
239 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38531395 |
ggtttttataagttttccaaaaaaaataaagagaaaagtgaaatcacgaaaatgattctggagtatgcgaga |
38531466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3974 times since January 2019
Visitors: 4825