View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_32 (Length: 307)
Name: NF0735_low_32
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 67 - 238
Target Start/End: Original strand, 38531295 - 38531466
Alignment:
| Q |
67 |
gttttgttgaataacgtttgtctaggtttaacaaacatgaagcatttaacaaaccatatatgtttggcaaagttttccggaaagaaaatctaacgaggta |
166 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38531295 |
gttttgttgaataacgtttgtcaaggtttaacaaacatgaagcatttaacaaaccatatatgtttggcaaagttttccggaaagaaaatctaacgaggta |
38531394 |
T |
|
| Q |
167 |
ggtttttataagttttccnnnnnnnntaaagagaaaagtgaaatcacgaaaatgattctggagtatgcgaga |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38531395 |
ggtttttataagttttccaaaaaaaataaagagaaaagtgaaatcacgaaaatgattctggagtatgcgaga |
38531466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3456 times since January 2019
Visitors: 4814