View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_33 (Length: 307)
Name: NF0735_low_33
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 16102389 - 16102617
Alignment:
| Q |
1 |
agacaaccagcaataaattgtgagcacgtttctgatcctttcactgtcacttgacctgttctccaaatagttaaatcatcacaagataccaaaacaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16102389 |
agacaaccagcaataaattgtgagcacgtttctgatcctttcactgtcacttgacctgttctccaaatagttaaatcatcacaagataccaaaacaataa |
16102488 |
T |
|
| Q |
101 |
aataaaaacatgaaaatttaattcgtaatgttacattgatttgagtgaaactaaattcagatccattaaataaggtctcgaattcaaaccctagatgaaa |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16102489 |
aataaaaagatgaaaatttaattcgtaatgttacattgatttgagtgaaactaaattcagatccattaaataaggtctcgaattcaaaccctagatgaaa |
16102588 |
T |
|
| Q |
201 |
gnnnnnnnnggttgaatagaagaccccac |
229 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
16102589 |
gaaaaaaaaggttgaatagaagaccccac |
16102617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3148 times since January 2019
Visitors: 4805