View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_37 (Length: 293)
Name: NF0735_low_37
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 79 - 223
Target Start/End: Original strand, 39553836 - 39553980
Alignment:
Q |
79 |
cagagatggggacatacatgtcataaattgaaggatggatggaaggtgggcgtcgtggggtcataagtgaccgtctaaaacaaggttgcgttattgggat |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
T |
39553836 |
cagagatggggacatacatgtcataaattgaaggatggatggaaggtgggcgtcgtggggtcagaagtgaccgtcgaaaacaaggttgcgttgttgggat |
39553935 |
T |
 |
Q |
179 |
caaagacttgttatcattgggccgagctatctcggcccatgatac |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39553936 |
caaagacttgttatcattgggccgagctatctcggcccatgatac |
39553980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 79 - 223
Target Start/End: Original strand, 39543817 - 39543961
Alignment:
Q |
79 |
cagagatggggacatacatgtcataaattgaaggatggatggaaggtgggcgtcgtggggtcataagtgaccgtctaaaacaaggttgcgttattgggat |
178 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
T |
39543817 |
cagagatggggacatacatgtcataaagtgaaggatgtatggaaggtgggcgtcgtggggtcataagtgaccgtctaaaacaaggttgcattgttgggat |
39543916 |
T |
 |
Q |
179 |
caaagacttgttatcattgggccgagctatctcggcccatgatac |
223 |
Q |
|
|
|||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
39543917 |
caaagacttgttattgttgggtcgagctatctcggcccatgatac |
39543961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 81 - 223
Target Start/End: Original strand, 39586948 - 39587090
Alignment:
Q |
81 |
gagatggggacatacatgtcataaattgaaggatggatggaaggtgggcgtcgtggggtcataagtgaccgtctaaaacaaggttgcgttattgggatca |
180 |
Q |
|
|
|||||||||| ||||||||||| | |||||||||||||||||||||| ||| |||||||| ||| |||| | |||||||||||| ||| ||||||||| |
|
|
T |
39586948 |
gagatggggatgtacatgtcatagagtgaaggatggatggaaggtgggtgtcttggggtcagaagggacctttgaaaacaaggttgtgttgttgggatca |
39587047 |
T |
 |
Q |
181 |
aagacttgttatcattgggccgagctatctcggcccatgatac |
223 |
Q |
|
|
|||||||||||| | | || |||||||||||||||||||| |
|
|
T |
39587048 |
aagacttgttattgctcgatcgggctatctcggcccatgatac |
39587090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3463 times since January 2019
Visitors: 4814