View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_39 (Length: 291)
Name: NF0735_low_39
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_39 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 37 - 291
Target Start/End: Original strand, 36576328 - 36576584
Alignment:
| Q |
37 |
tagcaatgggggcgatgtggat-tgggcagtaatcccatgtcacctgttatcaaaataaagtaatactatgtcacccctcaactcagtgatgattagcct |
135 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36576328 |
tagcaatgggggcgatgtggatgtgtgcagtaatcccatgtcacctgttatcaaaatagagtaatactatgtcacccctcaactcagtgataattagcct |
36576427 |
T |
|
| Q |
136 |
tgtgttcacccatacccacaatgcatttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttacagtatccgaatcagaagtg |
235 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
36576428 |
tgtgttcacccatactcaaaatgcatttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttatagtatccaaatcagaagtg |
36576527 |
T |
|
| Q |
236 |
ctttatgtcacaaca-tgatagtaaaacattttcgttgactactcaacatgccatgc |
291 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36576528 |
ctttatgtcacaacactgatagtaaaacattttcattgactactcaacatgccatgc |
36576584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3314 times since January 2019
Visitors: 4812