View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_40 (Length: 286)
Name: NF0735_low_40
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 47 - 235
Target Start/End: Complemental strand, 24463805 - 24463615
Alignment:
| Q |
47 |
agctgttgcagaattccggcggacccatgctgacacatggaatgttcagaaagagttattcactgaagagcagcttgaggtagcttttatgtagacgaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24463805 |
agctgttgcagaattccggcggacccatgctgacacatggaatgttcagaaagagttattcactgaagagcagcttgaggtagcttttatgtagacgaaa |
24463706 |
T |
|
| Q |
147 |
catagtgtgctatgatttggaaaacgtaattattacttgtgttttttattt--tatgtgtcctaatgtttatttctcccccatattgacag |
235 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24463705 |
catattgtgctatgatttggaaaacgtaattattacttgtgttttttattttatatgtgtcctaatgtttatttctcccccatattcacag |
24463615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 47 - 235
Target Start/End: Complemental strand, 24438576 - 24438385
Alignment:
| Q |
47 |
agctgttgcagaattccggcggacccatgctgacacatggaatgttcagaaagagttattcactgaagagcagcttgaggtagcttt-tatgtagacgaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
24438576 |
agctgttgcagaattccggcggacccatgctgacacatggaatgttcagaaagagttattcactaaagagcaacttgaggtagctttctatgtagacgaa |
24438477 |
T |
|
| Q |
146 |
acatagtgtgctatgatttggaaaacgtaattattacttgtgttttttattt--tatgtgtcctaatgtttatttctcccccatattgacag |
235 |
Q |
| |
|
|| || |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
24438476 |
acgtattgtgctatgatttggaaaacctaattattacttgtgttttttattttatatgtgtcctaatgtttatttttcccccatattcacag |
24438385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5280 times since January 2019
Visitors: 4847