View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_48 (Length: 260)
Name: NF0735_low_48
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 76 - 239
Target Start/End: Complemental strand, 4656339 - 4656180
Alignment:
| Q |
76 |
gagggaatcctattccaattatcacccatgcataacacatgggttctatataatttatttattttgggacatgggctccatataaataaatattgaccac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
4656339 |
gagggaatcctattccaattatcacccatgcataacacatgggttctatataatttatttattttgggacgtgggctccataaaaataaatattgaccac |
4656240 |
T |
 |
| Q |
176 |
nnnnnnngtttcatttatctttggaagtcttgaaatattgagagaacccctcgtgttaattgag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
4656239 |
aaaaaaagtttcatttatctttggaagtcttgaaatatt----gaacccatcgtgttaattgag |
4656180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University